-
PurposeLentiviral expression of doxycycline-inducible dominant negative Rac1 and co-expression of Venus
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 84642 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepSLIK
-
Backbone manufacturerIain Fraser (Addgene plasmid # 25734)
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersVenus
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameRac1
-
SpeciesH. sapiens (human)
-
MutationDominant Negative
-
Entrez GeneRAC1 (a.k.a. MIG5, MRD48, Rac-1, TC-25, p21-Rac1)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer pTYF-5 GTAGACATAATAGCAACAGAC
- 3′ sequencing primer hUBCpro-R CTAAGGCCGAGTCTTATGAGCAG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The insert contains T17N mutation compared to best match reference sequence (NP_008839.2). The depositor states that this mutation does not affect plasmid function.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSLIK DN Rac1 was a gift from Sanjay Kumar (Addgene plasmid # 84642 ; http://n2t.net/addgene:84642 ; RRID:Addgene_84642) -
For your References section:
Simultaneous and independent tuning of RhoA and Rac1 activity with orthogonally inducible promoters. MacKay JL, Kumar S. Integr Biol (Camb). 2014 Sep;6(9):885-94. doi: 10.1039/c4ib00099d. 10.1039/c4ib00099d PubMed 25044255