Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pSLIK DN RhoA
(Plasmid #84646)

Loading...

Full plasmid sequence is not available for this item.

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 84646 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pSLIK
  • Backbone manufacturer
    Iain Fraser (Addgene plasmid # 25734)
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Venus

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    RhoA
  • Species
    H. sapiens (human)
  • Mutation
    Dominant Negative
  • Entrez Gene
    RHOA (a.k.a. ARH12, ARHA, EDFAOB, RHO12, RHOH12)
  • Tag / Fusion Protein
    • Myc (N terminal on insert)

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer pTYF-5 GTAGACATAATAGCAACAGAC
  • 3′ sequencing primer hUBCpro-R CTAAGGCCGAGTCTTATGAGCAG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Insert contains T19N in RhoA insert compared to best match reference sequence (NP_001655.1)

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSLIK DN RhoA was a gift from Sanjay Kumar (Addgene plasmid # 84646 ; http://n2t.net/addgene:84646 ; RRID:Addgene_84646)
  • For your References section:

    Simultaneous and independent tuning of RhoA and Rac1 activity with orthogonally inducible promoters. MacKay JL, Kumar S. Integr Biol (Camb). 2014 Sep;6(9):885-94. doi: 10.1039/c4ib00099d. 10.1039/c4ib00099d PubMed 25044255