Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pMyC-kan
(Plasmid #84692)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 84692 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pMyC
  • Backbone manufacturer
    Wilmanns lab
  • Backbone size (bp) 6876
  • Modifications to backbone
    The hygromycin resistance cassette in pMyC was replaced by a kanamycin resistance cassette using Gibson cloning. The pMyC backbone was amplified using the primers : 5’-agcggacctctattcacagggt and 5’-cgccccctctagctgatcac and the kanamycin resistance cassette from pMV306 was amplified using the primers 5’-gtgaatagaggtccgctcaacaaagcgacgttgtgtctca and 5’-cagctagagggggcgctgattagaaaaactcatcgagcatcaaatg.
  • Vector type
    Bacterial Expression
  • Promoter Acetamidase
  • Tag / Fusion Protein
    • His6 (C terminal on backbone)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CGCAGTTGTTCTCGCATACC
  • 3′ sequencing primer TTGATGACGAGCGTAATGGC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMyC-kan was a gift from Matthias Wilmanns (Addgene plasmid # 84692 ; http://n2t.net/addgene:84692 ; RRID:Addgene_84692)
  • For your References section:

    The pMy vector series: A versatile cloning platform for the recombinant production of mycobacterial proteins in Mycobacterium smegmatis. Beckham KSH, Staack S, Wilmanns M, Parret AHA. Protein Sci. 2020 Oct 2. doi: 10.1002/pro.3962. 10.1002/pro.3962 PubMed 33006405