-
PurposeExpresses huAsCpf1-T2A-GFP and crRNA guide
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 84743 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepcDNA3.1
- Backbone size w/o insert (bp) 5620
- Total vector size (bp) 10505
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert namehuAsCpf1
-
Alt nameAsCas12a
-
SpeciesSynthetic
- Promoter CMV
-
Tags
/ Fusion Proteins
- NLS (C terminal on insert)
- 3xHA (C terminal on insert)
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer cgcaaatgggcggtaggcgtg (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameGFP
-
SpeciesSynthetic
-
Tag
/ Fusion Protein
- T2A (N terminal on insert)
Resource Information
-
A portion of this plasmid was derived from a plasmid made by
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Modified pY026 plasmid with T2A-GFP after huAsCpf1.
Contains a BsmBI cloning cassette for U6 driven crRNA expression.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pY094 was a gift from Feng Zhang (Addgene plasmid # 84743 ; http://n2t.net/addgene:84743 ; RRID:Addgene_84743) -
For your References section:
Multiplex gene editing by CRISPR-Cpf1 using a single crRNA array. Zetsche B, Heidenreich M, Mohanraju P, Fedorova I, Kneppers J, DeGennaro EM, Winblad N, Choudhury SR, Abudayyeh OO, Gootenberg JS, Wu WY, Scott DA, Severinov K, van der Oost J, Zhang F. Nat Biotechnol. 2017 Jan;35(1):31-34. doi: 10.1038/nbt.3737. Epub 2016 Dec 5. 10.1038/nbt.3737 PubMed 27918548