Skip to main content

LCV2 V-5
(Plasmid #84808)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 84808 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    LentiCRISPRv2
  • Backbone manufacturer
    Feng Zhang lab (Addgene #52961)
  • Vector type
    Mammalian Expression, Lentiviral, CRISPR
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    gRNA targeting VEGF-A
  • gRNA/shRNA sequence
    TCGGAAGCCGGGCTCATGGA
  • Species
    H. sapiens (human)
  • Entrez Gene
    VEGFA (a.k.a. L-VEGF, MVCD1, VEGF, VPF)
  • Promoter U6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsmBI (unknown if destroyed)
  • 3′ cloning site BsmBI (unknown if destroyed)
  • 5′ sequencing primer LKO.1 5' (GACTATCATATGCTTACCGT)
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    LCV2 V-5 was a gift from Glenn Yiu (Addgene plasmid # 84808 ; http://n2t.net/addgene:84808 ; RRID:Addgene_84808)
  • For your References section:

    Genomic Disruption of VEGF-A Expression in Human Retinal Pigment Epithelial Cells Using CRISPR-Cas9 Endonuclease. Yiu G, Tieu E, Nguyen AT, Wong B, Smit-McBride Z. Invest Ophthalmol Vis Sci. 2016 Oct 1;57(13):5490-5497. doi: 10.1167/iovs.16-20296. 10.1167/iovs.16-20296 PubMed 27768202