LCV2 V-5
(Plasmid
#84808)
-
PurposeCas9 with sgRNA targeting Exon 1 of VEGF-A
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 84808 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneLentiCRISPRv2
-
Backbone manufacturerFeng Zhang lab (Addgene #52961)
-
Vector typeMammalian Expression, Lentiviral, CRISPR
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namegRNA targeting VEGF-A
-
gRNA/shRNA sequenceTCGGAAGCCGGGCTCATGGA
-
SpeciesH. sapiens (human)
-
Entrez GeneVEGFA (a.k.a. L-VEGF, MVCD1, VEGF, VPF)
- Promoter U6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsmBI (unknown if destroyed)
- 3′ cloning site BsmBI (unknown if destroyed)
- 5′ sequencing primer LKO.1 5' (GACTATCATATGCTTACCGT)
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
LCV2 V-5 was a gift from Glenn Yiu (Addgene plasmid # 84808 ; http://n2t.net/addgene:84808 ; RRID:Addgene_84808) -
For your References section:
Genomic Disruption of VEGF-A Expression in Human Retinal Pigment Epithelial Cells Using CRISPR-Cas9 Endonuclease. Yiu G, Tieu E, Nguyen AT, Wong B, Smit-McBride Z. Invest Ophthalmol Vis Sci. 2016 Oct 1;57(13):5490-5497. doi: 10.1167/iovs.16-20296. 10.1167/iovs.16-20296 PubMed 27768202