-
PurposeConstitutive Expression plasmid with mCherry fluorescent protein
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 84821 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepMMB207c
- Backbone size w/o insert (bp) 9077
- Total vector size (bp) 9785
-
Modifications to backboneThe lac repressor binding site (operator) was mutated, likely abrogating binding of the repressor to the DNA and resulting in constitutive expression from the Lac promoter harbored by the plasmid.
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert namemCherry
-
Insert Size (bp)708
- Promoter Tac Promoter
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI or NdeI (not destroyed)
- 3′ cloning site XbaI (not destroyed)
- 5′ sequencing primer TCGGCTCGTATAATGTGTGGAATTGTG
- 3′ sequencing primer CAGACCGCTTCTGCGTTCTGAT (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byThe mCherry fragment was sub-cloned from plasmid pXDC50, created by Xavier Charpentier
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pON.mCherry was a gift from Howard Shuman (Addgene plasmid # 84821 ; http://n2t.net/addgene:84821 ; RRID:Addgene_84821) -
For your References section:
Seeing red; the development of pON.mCherry, a broad-host range constitutive expression plasmid for Gram-negative bacteria. Gebhardt MJ, Jacobson RK, Shuman HA. PLoS One. 2017 Mar 3;12(3):e0173116. doi: 10.1371/journal.pone.0173116. eCollection 2017. PONE-D-16-41433 [pii] PubMed 28257493