Skip to main content
Addgene

pAav-MCS-PQS1-3xFLAG
(Plasmid #84883)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 84883 Standard format: Plasmid sent in bacteria as agar stab 1 $89

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.
  • Serotype
    Select serotype for details
  • Pricing
    Select serotype and quantity
  • How this works
    • Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
    • Addgene will quickly confirm that we can produce a high-quality prep for you.
    • Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
    • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
    • Learn more about our Packaged on Request Service.

Backbone

  • Vector backbone
    pAAV-MCS
  • Backbone manufacturer
    agilent
  • Backbone size w/o insert (bp) 4650
  • Total vector size (bp) 4863
  • Vector type
    AAV
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Multicloning sites and selection cassette
  • Alt name
    MCS-LOX-PGK-NEO-LOX-MCS
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    1962
  • Promoter PGK

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site MluI (not destroyed)
  • 3′ cloning site PmlI (destroyed during cloning)
  • 5′ sequencing primer CCTCTGACTTGAGCGTCGAT
  • 3′ sequencing primer TACTATGGTTGCTTTGACGT
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Sequencing over ITR sequences may be difficult. We used additional internal sequencing primers

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAav-MCS-PQS1-3xFLAG was a gift from Sven Eyckerman (Addgene plasmid # 84883 ; http://n2t.net/addgene:84883 ; RRID:Addgene_84883)
  • For your References section:

    An extra dimension in protein tagging by quantifying universal proteotypic peptides using targeted proteomics. Vandemoortele G, Staes A, Gonnelli G, Samyn N, De Sutter D, Vandermarliere E, Timmerman E, Gevaert K, Martens L, Eyckerman S. Sci Rep. 2016 Jun 6;6:27220. doi: 10.1038/srep27220. 10.1038/srep27220 PubMed 27264994