Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

pBABEbleo-Flag-BRAFV600E
(Plasmid #53156)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 53156 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pBABEbleo(zeo)
  • Backbone size w/o insert (bp) 4888
  • Total vector size (bp) 7188
  • Vector type
    Mammalian Expression, Retroviral
  • Selectable markers
    Zeocin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    XL10 Gold
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    BRAF
  • Alt name
    B-Raf proto-oncogene serine/threonine-protein kinase
  • Alt name
    BRAF1
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    2300
  • Mutation
    V600E
  • GenBank ID
    NM_004333.4
  • Entrez Gene
    BRAF (a.k.a. B-RAF1, B-raf, BRAF-1, BRAF1, NS7, RAFB1)
  • Tag / Fusion Protein
    • FLAG (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SalI (not destroyed)
  • 3′ cloning site SalI (not destroyed)
  • 5′ sequencing primer CTTTATCCAGCCCTCAC
  • 3′ sequencing primer ACCCTAACTGACACACATTCC
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Addgene Plasmid 15269: pBabe-Puro-BRAF-V600E
  • Articles Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pBABEbleo-Flag-BRAFV600E was a gift from Christopher Counter (Addgene plasmid # 53156 ; http://n2t.net/addgene:53156 ; RRID:Addgene_53156)
  • For your References section:

    Copper is required for oncogenic BRAF signalling and tumorigenesis. Brady DC, Crowe MS, Turski ML, Hobbs GA, Yao X, Chaikuad A, Knapp S, Xiao K, Campbell SL, Thiele DJ, Counter CM. Nature. 2014 Apr 9. doi: 10.1038/nature13180. 10.1038/nature13180 PubMed 24717435