pBABEbleo-Flag-BRAFV600E
(Plasmid #53156)

• Purpose: Expresses Flag tagged human oncogenic BRAFV600E from bleomycin resistance retroviral vector
• Depositing Lab: Christopher Counter
• Publication: Brady et al Nature. 2014 Apr 9. doi: 10.1038/nature13180.

Backbone

• Vector backbone: pBABEbleo(zeo)
• Backbone size w/o insert (bp): 4888
• Total vector size (bp): 7188
• Vector type: Mammalian Expression, Retroviral
• Selectable markers: Zeocin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): XL10 Gold
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: BRAF
• Alt name: B-Raf proto-oncogene serine/threonine-protein kinase
• Alt name: BRAF1
• Species: H. sapiens (human)
• Insert Size (bp): 2300
• Mutation: V600E
• GenBank ID: NM_004333.4
• Entrez Gene: BRAF (a.k.a. B-RAF1, B-raf, BRAF-1, BRAF1, NS7, RAFB1)
• Tag / Fusion Protein:
  • FLAG (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: SalI (not destroyed)
• 3′ cloning site: SalI (not destroyed)
• 5′ sequencing primer: CTTTATCCAGCCCTCAC
• 3′ sequencing primer: ACCCTAACTGACACACATTCC

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Addgene Plasmid 15269: pBabe-Puro-BRAF-V600E
• Articles Citing this Plasmid:
  • 6 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry