Skip to main content

pK237.U6-Chimeric-CAG-loxP-stop-loxP-hspCas9 (Supernova)
(Plasmid #85041)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 85041 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pX330-U6-Chimeric_BB-CBh-hSpCas9 (Addgene Plasmid #42230)
  • Backbone size w/o insert (bp) 7968
  • Total vector size (bp) 10782
  • Vector type
    Mammalian Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    loxP-stop-loxP
  • Species
    P1 phage, SV40
  • Insert Size (bp)
    2814

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SnaBI (not destroyed)
  • 3′ cloning site AgeI (not destroyed)
  • 5′ sequencing primer caagtacgccccctattgacgtcaatgacggtaaat
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pK237.U6-Chimeric-CAG-loxP-stop-loxP-hspCas9 (Supernova) was a gift from Takuji Iwasato (Addgene plasmid # 85041 ; http://n2t.net/addgene:85041 ; RRID:Addgene_85041)
  • For your References section:

    Supernova: A Versatile Vector System for Single-Cell Labeling and Gene Function Studies in vivo. Luo W, Mizuno H, Iwata R, Nakazawa S, Yasuda K, Itohara S, Iwasato T. Sci Rep. 2016 Oct 24;6:35747. doi: 10.1038/srep35747. 10.1038/srep35747 PubMed 27775045