-
PurposeThis plasmid should be used for Cre/loxP-based Supernova-CRISPR/Cas9.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 85041 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepX330-U6-Chimeric_BB-CBh-hSpCas9 (Addgene Plasmid #42230)
- Backbone size w/o insert (bp) 7968
- Total vector size (bp) 10782
-
Vector typeMammalian Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameloxP-stop-loxP
-
SpeciesP1 phage, SV40
-
Insert Size (bp)2814
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SnaBI (not destroyed)
- 3′ cloning site AgeI (not destroyed)
- 5′ sequencing primer caagtacgccccctattgacgtcaatgacggtaaat (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pK237.U6-Chimeric-CAG-loxP-stop-loxP-hspCas9 (Supernova) was a gift from Takuji Iwasato (Addgene plasmid # 85041 ; http://n2t.net/addgene:85041 ; RRID:Addgene_85041) -
For your References section:
Supernova: A Versatile Vector System for Single-Cell Labeling and Gene Function Studies in vivo. Luo W, Mizuno H, Iwata R, Nakazawa S, Yasuda K, Itohara S, Iwasato T. Sci Rep. 2016 Oct 24;6:35747. doi: 10.1038/srep35747. 10.1038/srep35747 PubMed 27775045