pF714-pET28a-Hs-FL-METTL20-NHis wt
(Plasmid
#85115)
-
Purposeexpression of recombinant human full-length METTL20 wt with N-terminal 6xHis-tag
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 85115 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepET28a
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert namehuman full-length METTL20
-
SpeciesH. sapiens (human)
-
Insert Size (bp)789
-
Entrez GeneMETTL20 (a.k.a. C12orf72, MGC50559)
- Promoter T7
-
Tag
/ Fusion Protein
- 6xHis (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NdeI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer ATGCGTCCGGCGTAGAGG
- 3′ sequencing primer TAGAGGCCCCAAGGGGTTATGCTAG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Homo sapiens wt METTL20, full-length, cloned into NdeI-NotI sites of pET28a, contains a N-terminal His-tag
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pF714-pET28a-Hs-FL-METTL20-NHis wt was a gift from Pal Falnes (Addgene plasmid # 85115 ; http://n2t.net/addgene:85115 ; RRID:Addgene_85115) -
For your References section:
Human METTL20 is a mitochondrial lysine methyltransferase that targets the beta subunit of electron transfer flavoprotein (ETFbeta) and modulates its activity. Malecki J, Ho AY, Moen A, Dahl HA, Falnes PO. J Biol Chem. 2015 Jan 2;290(1):423-34. doi: 10.1074/jbc.M114.614115. Epub 2014 Nov 21. 10.1074/jbc.M114.614115 PubMed 25416781