Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

pYES260-sc.eEF2 K509A
(Plasmid #85120)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 85120 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pYES260
  • Backbone manufacturer
    Euroscarf (Melcher)
  • Backbone size w/o insert (bp) 5933
  • Vector type
    Yeast Expression
  • Selectable markers
    URA3

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    EFT1/EFT2
  • Alt name
    EEF2
  • Species
    S. cerevisiae (budding yeast)
  • Insert Size (bp)
    2529
  • Mutation
    K509A
  • Entrez Gene
    EFT2 (a.k.a. YDR385W)
  • Entrez Gene
    EFT1 (a.k.a. YOR133W)
  • Promoter GAL1
  • Tag / Fusion Protein
    • 6xHis (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NcoI (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer CGGACTACTAGCAGCTGTAATACGACTC
  • 3′ sequencing primer CTAATTACATGATGCGGCCCTCTAG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pYES260-sc.eEF2 K509A was a gift from Pal Falnes (Addgene plasmid # 85120 ; http://n2t.net/addgene:85120 ; RRID:Addgene_85120)
  • For your References section:

    Identification and characterization of a novel evolutionarily conserved lysine-specific methyltransferase targeting eukaryotic translation elongation factor 2 (eEF2). Davydova E, Ho AY, Malecki J, Moen A, Enserink JM, Jakobsson ME, Loenarz C, Falnes PO. J Biol Chem. 2014 Oct 31;289(44):30499-510. doi: 10.1074/jbc.M114.601658. Epub 2014 Sep 17. 10.1074/jbc.M114.601658 PubMed 25231979