Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Addgene is open for ordering and depositing; find up-to-date details here. To learn more about how we are supporting COVID-19 research and to find related plasmids, check out our COVID-19 and Coronavirus Plasmids & Resources page.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pYES260-sc.eEF2 K509A
(Plasmid #85120)


Item Catalog # Description Quantity Price (USD)
Plasmid 85120 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
    Euroscarf (Melcher)
  • Backbone size w/o insert (bp) 5933
  • Vector type
    Yeast Expression
  • Selectable markers

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    Low Copy


  • Gene/Insert name
  • Alt name
  • Species
    S. cerevisiae (budding yeast)
  • Insert Size (bp)
  • Mutation
  • Entrez Gene
    EFT2 (a.k.a. YDR385W)
  • Entrez Gene
    EFT1 (a.k.a. YOR133W)
  • Promoter GAL1
  • Tag / Fusion Protein
    • 6xHis (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NcoI (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 3′ sequencing primer CTAATTACATGATGCGGCCCTCTAG
  • (Common Sequencing Primers)

Resource Information

  • Terms and Licenses
  • Industry Terms
    • Not Available to Industry
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pYES260-sc.eEF2 K509A was a gift from Pal Falnes (Addgene plasmid # 85120 ; ; RRID:Addgene_85120)
  • For your References section:

    Identification and characterization of a novel evolutionarily conserved lysine-specific methyltransferase targeting eukaryotic translation elongation factor 2 (eEF2). Davydova E, Ho AY, Malecki J, Moen A, Enserink JM, Jakobsson ME, Loenarz C, Falnes PO. J Biol Chem. 2014 Oct 31;289(44):30499-510. doi: 10.1074/jbc.M114.601658. Epub 2014 Sep 17. 10.1074/jbc.M114.601658 PubMed 25231979