Skip to main content

pSB1A3 EcoRI-RTX with EcoRI Methylase-AmilCP
(Plasmid #85165)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 85165 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pSB1A3
  • Backbone manufacturer
    iGEM
  • Backbone size w/o insert (bp) 2155
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    EcoRI-RTX and EcoRI Methylase-AmilCP coding sequences
  • Alt name
    RTX tagged EcoRI restriction enzyme
  • Species
    E. coli strain RY13
  • Insert Size (bp)
    3020
  • Promoter J23100 promoter
  • Tags / Fusion Proteins
    • AmilCP (C terminal on insert)
    • RTX (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI, XbaI (not destroyed)
  • 3′ cloning site SpeI, PstI (not destroyed)
  • 5′ sequencing primer VF2 (5' tgccacctgacgtctaagaa 3')
  • 3′ sequencing primer VR (5' attaccgcctttgagtgagc 3')
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Promoter and AmilCP were acquired from iGEM repository.
  • Article Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

AmilCP is fused to the EcoRI Methylase. RTX tag is fused to the EcoRI restriction enzyme.
The methylase will methylate the EcoRI cloning site, rendering the site nonfunctional.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSB1A3 EcoRI-RTX with EcoRI Methylase-AmilCP was a gift from Robin Dowell (Addgene plasmid # 85165 ; http://n2t.net/addgene:85165 ; RRID:Addgene_85165)
  • For your References section:

    Engineered calcium-precipitable restriction enzyme. Hendrix J, Read T, Lalonde JF, Jensen PK, Heymann W, Lovelace E, Zimmermann SA, Brasino M, Rokicki J, Dowell RD. ACS Synth Biol. 2014 Dec 19;3(12):969-71. doi: 10.1021/sb500042m. 10.1021/sb500042m PubMed 25524101