-
PurposeProvides the coding region to express the EcoRI restriction enzyme. The RTX tag allows the EcoRI enzyme to be isolated via calcium-precipitation.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 85165 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepSB1A3
-
Backbone manufactureriGEM
- Backbone size w/o insert (bp) 2155
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameEcoRI-RTX and EcoRI Methylase-AmilCP coding sequences
-
Alt nameRTX tagged EcoRI restriction enzyme
-
SpeciesE. coli strain RY13
-
Insert Size (bp)3020
- Promoter J23100 promoter
-
Tags
/ Fusion Proteins
- AmilCP (C terminal on insert)
- RTX (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI, XbaI (not destroyed)
- 3′ cloning site SpeI, PstI (not destroyed)
- 5′ sequencing primer VF2 (5' tgccacctgacgtctaagaa 3')
- 3′ sequencing primer VR (5' attaccgcctttgagtgagc 3') (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byPromoter and AmilCP were acquired from iGEM repository.
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
AmilCP is fused to the EcoRI Methylase. RTX tag is fused to the EcoRI restriction enzyme.
The methylase will methylate the EcoRI cloning site, rendering the site nonfunctional.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSB1A3 EcoRI-RTX with EcoRI Methylase-AmilCP was a gift from Robin Dowell (Addgene plasmid # 85165 ; http://n2t.net/addgene:85165 ; RRID:Addgene_85165) -
For your References section:
Engineered calcium-precipitable restriction enzyme. Hendrix J, Read T, Lalonde JF, Jensen PK, Heymann W, Lovelace E, Zimmermann SA, Brasino M, Rokicki J, Dowell RD. ACS Synth Biol. 2014 Dec 19;3(12):969-71. doi: 10.1021/sb500042m. 10.1021/sb500042m PubMed 25524101