-
PurposeExpresses YE2-BE3 in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 85176 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneCMV
-
Backbone manufacturerorigene
- Backbone size w/o insert (bp) 3399
- Total vector size (bp) 8532
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameYEE-BE3
-
Alt namerAPOBEC1(W80Y/R126E/R132E)-XTEN-Cas9n-UGI-NLS
-
SpeciesR. norvegicus (rat); S. pyogenes
-
Insert Size (bp)5133
- Promoter CMV
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer CMV
- 3′ sequencing primer TGGTTCTTTCCGCCTCAGAAGC
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byCloned from Addgene #73021
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pBK-YE2-BE3 was a gift from David Liu (Addgene plasmid # 85176 ; http://n2t.net/addgene:85176 ; RRID:Addgene_85176) -
For your References section:
Increasing the genome-targeting scope and precision of base editing with engineered Cas9-cytidine deaminase fusions. Kim YB, Komor AC, Levy JM, Packer MS, Zhao KT, Liu DR. Nat Biotechnol. 2017 Feb 13. doi: 10.1038/nbt.3803. 10.1038/nbt.3803 PubMed 28191901