This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #85176)


Item Catalog # Description Quantity Price (USD)
Plasmid 85176 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
  • Backbone size w/o insert (bp) 3399
  • Total vector size (bp) 8532
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy


  • Gene/Insert name
  • Alt name
  • Species
    R. norvegicus (rat); S. pyogenes
  • Insert Size (bp)
  • Promoter CMV

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer CMV
  • 3′ sequencing primer TGGTTCTTTCCGCCTCAGAAGC
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    Cloned from Addgene #73021
  • Terms and Licenses
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pBK-YE2-BE3 was a gift from David Liu (Addgene plasmid # 85176)
  • For your References section:

    Increasing the genome-targeting scope and precision of base editing with engineered Cas9-cytidine deaminase fusions. Kim YB, Komor AC, Levy JM, Packer MS, Zhao KT, Liu DR. Nat Biotechnol. 2017 Feb 13. doi: 10.1038/nbt.3803. 10.1038/nbt.3803 PubMed 28191901