-
PurposeLentiviral vector expressing dKatushka2 fluorescent protein driven by SFFV promoter
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 85214 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneLeGO vector
- Backbone size w/o insert (bp) 6417
- Total vector size (bp) 7134
-
Vector typeMammalian Expression, Lentiviral, Cre/Lox
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namedKatushka2
-
SpeciesSynthetic
-
Insert Size (bp)717
-
MutationBsrGI site removed at 5' end, BsrGI site inserted at 3' end.
- Promoter SFFV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI, NcoI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer GAGCTCACAACCCCTCACTC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made bydKatushka2 cDNA was derived from Addgene plasmid #30181. The lenti backbone is a derivative of pLentiLox3.7 (Addgene plasmid #11795) developed at the MIT (http://web.mit.edu/jacks-lab/protocols/pll37.htm).
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
HIV-1 derived third generation lentiviral vector for stable cell marking. Use second generation (like psPAX2) or third generation (like pMDLg/pRRE + pRSV-Rev) systems for packaging in addition to a VSV-G expressing plasmid (or another envelope protein). Please visit the LeGO-Vector home page for more information: http://www.LentiGO-Vectors.de
The cDNA of dKatushka2 was slightly modified to remove a BsrGI site close to the 5' end and to insert a BsrGI site close to the 3' end. The BsrGI site can now be used to fuse an antibiotic resistance to the fluorescent protein following the building block principle of the LeGO vector system. More information is available on the LeGO website and in the following publications.
More references:
Weber et al., Molecular Therapy, 2008:
http://www.nature.com/mt/journal/v16/n4/full/mt20086a.html
Weber et al., Gene Therapy, 2010:
http://www.nature.com/gt/journal/v17/n4/full/gt2009149a.html
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
LeGO-dKatushka2 was a gift from Boris Fehse (Addgene plasmid # 85214 ; http://n2t.net/addgene:85214 ; RRID:Addgene_85214) -
For your References section:
Optical Barcoding for Single-Clone Tracking to Study Tumor Heterogeneity. Mohme M, Maire CL, Riecken K, Zapf S, Aranyossy T, Westphal M, Lamszus K, Fehse B. Mol Ther. 2017 Jan 18. pii: S1525-0016(16)45496-1. doi: 10.1016/j.ymthe.2016.12.014. 10.1016/j.ymthe.2016.12.014 PubMed 28109958