Skip to main content
Addgene

pAAV hSyn1 bPAC cMyc T2A tDimer
(Plasmid #85397)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 85397 Standard format: Plasmid sent in bacteria as agar stab 1 $89

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.
  • Serotype
    Select serotype for details
  • Pricing
    Select serotype and quantity
  • How this works
    • Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
    • Addgene will quickly confirm that we can produce a high-quality prep for you.
    • Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
    • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
    • Learn more about our Packaged on Request Service.

Backbone

  • Vector backbone
    pAAV
  • Backbone manufacturer
    Stratagene
  • Backbone size w/o insert (bp) 4568
  • Total vector size (bp) 7176
  • Modifications to backbone
    Synapsin promoter
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    humanized photoactivated adenylyl cyclase
  • Alt name
    bPAC
  • Alt name
    BlaC
  • Alt name
    Beggiatoa sp. PS
  • Species
    GU461306
  • Insert Size (bp)
    1092
  • Promoter human synapsin-1
  • Tag / Fusion Protein
    • cMyc Tag (C terminal on insert)

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site MluI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer tttcgccacctctgactt
  • 3′ sequencing primer GTACTCGGTTTTCAGGCACAG
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    red fluorescent protein
  • Alt name
    tdimer2
  • Species
    Discosoma sp.
  • Insert Size (bp)
    1395
  • Promoter ribosomal skip sequence T2A

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site KpnI (not destroyed)
  • 3′ cloning site HindIII (not destroyed)
  • 5′ sequencing primer GGCAGAGGAAGTCTTCTAACAT
  • 3′ sequencing primer GTAATCCAGAGGTTGATTATCG
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    bPAC was a gift from Peter Hegemann, HU Berlin, Germany tdimer2 is originally from Roger Y. Tsien, UCSD

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Insert was described in Stierl et al J Biol Chem. 2011 Jan 14. 286(2):1181-8 and cloned behind a neuron-specific promoter.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV hSyn1 bPAC cMyc T2A tDimer was a gift from Thomas Oertner (Addgene plasmid # 85397 ; http://n2t.net/addgene:85397 ; RRID:Addgene_85397)