pAAV hSyn1 bPAC cMyc S27A 2A tDimer
(Plasmid #85398)

• Purpose: humanized photoactivated adenylyl cyclase lower dark activity, spectrum shifted 15 nm longer wavelenght with neuron-specific promoter, plus red fluorescent protein
• Depositing Lab: Thomas Oertner
• Publication: Thomas Oertner Lab Plasmids (unpublished)

Backbone

• Vector backbone: pAAV
• Backbone manufacturer: Stratagene
• Backbone size w/o insert (bp): 4568
• Total vector size (bp): 7176
• Modifications to backbone: human Synapsin1 promoter
• Vector type: Mammalian Expression, AAV

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: humanized photoactivated adenylyl cyclase
• Alt name: bPAC S27A
• Alt name: BlaC
• Alt name: Beggiatoa sp. PS
• Species: GU461306
• Insert Size (bp): 1092
• Mutation: S27A
• Promoter: human Synapsin1 promotor
• Tag / Fusion Protein:
  • cMyc Tag (C terminal on insert)

Cloning Information for Gene/Insert 1

• Cloning method: Restriction Enzyme
• 5′ cloning site: MluI (not destroyed)
• 3′ cloning site: EcoRI (not destroyed)
• 5′ sequencing primer: tttcgccacctctgactt
• 3′ sequencing primer: GTACTCGGTTTTCAGGCACAG

Gene/Insert 2

• Gene/Insert name: red fluorescent protein
• Alt name: tdimer2
• Species: Discosoma sp.
• Insert Size (bp): 1395
• Promoter: ribosomal skip sequence T2A

Cloning Information for Gene/Insert 2

• Cloning method: Restriction Enzyme
• 5′ cloning site: KpnI (not destroyed)
• 3′ cloning site: HindIII (not destroyed)
• 5′ sequencing primer: GGCAGAGGAAGTCTTCTAACAT
• 3′ sequencing primer: GTAATCCAGAGGTTGATTATCG

Resource Information

• A portion of this plasmid was derived from a plasmid made by: ChR2 was a gift from Peter Hegemann, HU Berlin, Germany tdimer2 is originally from Roger Y. Tsien, UCSD

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Insert was described in Stierl et al Biochemistry. 2014 Aug 12;53(31):5121-30. doi: 10.1021/bi500479v. Epub 2014 Jul 28 and cloned behind a neuron-specific promoter.