Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.
As of April 1, 2023, we increased some of our prices. See the new prices and get more information or speak with our friendly support team.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pAAV hSyn1 bPAC cMyc T2A tDimer
(Plasmid #85397)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 85397 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pAAV
  • Backbone manufacturer
    Stratagene
  • Backbone size w/o insert (bp) 4568
  • Total vector size (bp) 7176
  • Modifications to backbone
    Synapsin promoter
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    humanized photoactivated adenylyl cyclase
  • Alt name
    bPAC
  • Alt name
    BlaC
  • Alt name
    Beggiatoa sp. PS
  • Species
    GU461306
  • Insert Size (bp)
    1092
  • Promoter human synapsin-1
  • Tag / Fusion Protein
    • cMyc Tag (C terminal on insert)

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site MluI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer tttcgccacctctgactt
  • 3′ sequencing primer GTACTCGGTTTTCAGGCACAG
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    red fluorescent protein
  • Alt name
    tdimer2
  • Species
    Discosoma sp.
  • Insert Size (bp)
    1395
  • Promoter ribosomal skip sequence T2A

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site KpnI (not destroyed)
  • 3′ cloning site HindIII (not destroyed)
  • 5′ sequencing primer GGCAGAGGAAGTCTTCTAACAT
  • 3′ sequencing primer GTAATCCAGAGGTTGATTATCG
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    bPAC was a gift from Peter Hegemann, HU Berlin, Germany tdimer2 is originally from Roger Y. Tsien, UCSD

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Insert was described in Stierl et al J Biol Chem. 2011 Jan 14. 286(2):1181-8 and cloned behind a neuron-specific promoter.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV hSyn1 bPAC cMyc T2A tDimer was a gift from Thomas Oertner (Addgene plasmid # 85397 ; http://n2t.net/addgene:85397 ; RRID:Addgene_85397)