Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.
Holiday Schedule: Addgene will be closed December 24 - January 1, 2020. For more information, see our holiday shipping schedule. If you have any questions, please contact us at [email protected].

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pAAV hSyn1 bPAC cMyc T2A tDimer
(Plasmid #85397)


Item Catalog # Description Quantity Price (USD)
Plasmid 85397 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
  • Backbone size w/o insert (bp) 4568
  • Total vector size (bp) 7176
  • Modifications to backbone
    Synapsin promoter
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    humanized photoactivated adenylyl cyclase
  • Alt name
  • Alt name
  • Alt name
    Beggiatoa sp. PS
  • Species
  • Insert Size (bp)
  • Promoter human synapsin-1
  • Tag / Fusion Protein
    • cMyc Tag (C terminal on insert)

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site MluI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer tttcgccacctctgactt
  • 3′ sequencing primer GTACTCGGTTTTCAGGCACAG
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    red fluorescent protein
  • Alt name
  • Species
    Discosoma sp.
  • Insert Size (bp)
  • Promoter ribosomal skip sequence T2A

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site KpnI (not destroyed)
  • 3′ cloning site HindIII (not destroyed)
  • 5′ sequencing primer GGCAGAGGAAGTCTTCTAACAT
  • 3′ sequencing primer GTAATCCAGAGGTTGATTATCG
  • (Common Sequencing Primers)

Resource Information

Depositor Comments

Insert was described in Stierl et al J Biol Chem. 2011 Jan 14. 286(2):1181-8 and cloned behind a neuron-specific promoter.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV hSyn1 bPAC cMyc T2A tDimer was a gift from Thomas Oertner (Addgene plasmid # 85397 ; ; RRID:Addgene_85397)