Skip to main content

DHFR-SpCas9-DHFR
(Plasmid #85447)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 85447 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    px330
  • Backbone manufacturer
    Feng Zhang
  • Total vector size (bp) 4234
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    DHFR-SpCas9-DHFR
  • Alt name
    DSpD
  • Species
    S. pyogenes
  • Insert Size (bp)
    5244
  • Promoter Cbh
  • Tags / Fusion Proteins
    • Destabilized domain (N-terminus version) of E.coli dihydrofolate reductase (N terminal on insert)
    • Destabilized domain (C-terminus version) of E.coli dihydrofolate reductase (C terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer agcgaagcgcgcggcgggcg
  • 3′ sequencing primer TAGAAGGCACAGTCGAGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    DHFR-SpCas9-DHFR was a gift from Amit Choudhary (Addgene plasmid # 85447 ; http://n2t.net/addgene:85447 ; RRID:Addgene_85447)
  • For your References section:

    Multidimensional chemical control of CRISPR-Cas9. Maji B, Moore CL, Zetsche B, Volz SE, Zhang F, Shoulders MD, Choudhary A. Nat Chem Biol. 2017 Jan;13(1):9-11. doi: 10.1038/nchembio.2224. Epub 2016 Oct 31. 10.1038/nchembio.2224 PubMed 27820801