Skip to main content

ER50-SpCas9-ER50
(Plasmid #85448)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 85448 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    px330
  • Backbone manufacturer
    Feng Zhang
  • Backbone size w/o insert (bp) 4234
  • Total vector size (bp) 10000
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    ER50-SpCas9-ER50
  • Alt name
    ESpE
  • Insert Size (bp)
    5766
  • Promoter Cbh
  • Tags / Fusion Proteins
    • destabilized domain of estrogen receptor ligand binding domain (N terminal on insert)
    • destabilized domain of estrogen receptor ligand binding domain (C terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer agcgaagcgcgcggcgggcg
  • 3′ sequencing primer TAGAAGGCACAGTCGAGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    ER50-SpCas9-ER50 was a gift from Amit Choudhary (Addgene plasmid # 85448 ; http://n2t.net/addgene:85448 ; RRID:Addgene_85448)
  • For your References section:

    Multidimensional chemical control of CRISPR-Cas9. Maji B, Moore CL, Zetsche B, Volz SE, Zhang F, Shoulders MD, Choudhary A. Nat Chem Biol. 2017 Jan;13(1):9-11. doi: 10.1038/nchembio.2224. Epub 2016 Oct 31. 10.1038/nchembio.2224 PubMed 27820801