-
PurposeExpresses SpCas9 fused to ER50 domain on both N- and C-termini in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 85448 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepx330
-
Backbone manufacturerFeng Zhang
- Backbone size w/o insert (bp) 4234
- Total vector size (bp) 10000
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameER50-SpCas9-ER50
-
Alt nameESpE
-
Insert Size (bp)5766
- Promoter Cbh
-
Tags
/ Fusion Proteins
- destabilized domain of estrogen receptor ligand binding domain (N terminal on insert)
- destabilized domain of estrogen receptor ligand binding domain (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer agcgaagcgcgcggcgggcg
- 3′ sequencing primer TAGAAGGCACAGTCGAGG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byGenewiz
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
ER50-SpCas9-ER50 was a gift from Amit Choudhary (Addgene plasmid # 85448 ; http://n2t.net/addgene:85448 ; RRID:Addgene_85448) -
For your References section:
Multidimensional chemical control of CRISPR-Cas9. Maji B, Moore CL, Zetsche B, Volz SE, Zhang F, Shoulders MD, Choudhary A. Nat Chem Biol. 2017 Jan;13(1):9-11. doi: 10.1038/nchembio.2224. Epub 2016 Oct 31. 10.1038/nchembio.2224 PubMed 27820801