SHP2(C459S)@pLKO-Trex-HA
(Plasmid
#85459)
-
PurposeExpresses SHP2 mutant in mammalian cells
-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 85459 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepLKO-trex-HA-DEST-Neo
- Backbone size w/o insert (bp) 9600
- Total vector size (bp) 11639
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameSHP2
-
Alt namePTPN11
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2200
-
MutationC459S
-
Entrez GenePTPN11 (a.k.a. BPTP3, CFC, JMML, METCDS, NS1, PTP-1D, PTP2C, SH-PTP2, SH-PTP3, SHP2)
- Promoter RSV
-
Tag
/ Fusion Protein
- HA (N terminal on backbone)
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer ATGACATCGCGGAGATGGTTTCACC
- 3′ sequencing primer TCATCTGAAACTTTTCTGCTGTTGC (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
SHP2(C459S)@pLKO-Trex-HA was a gift from Darrin Stuart (Addgene plasmid # 85459 ; http://n2t.net/addgene:85459 ; RRID:Addgene_85459) -
For your References section:
Allosteric inhibition of SHP2 phosphatase inhibits cancers driven by receptor tyrosine kinases. Chen YN, LaMarche MJ, Chan HM, Fekkes P, Garcia-Fortanet J, Acker MG, Antonakos B, Chen CH, Chen Z, Cooke VG, Dobson JR, Deng Z, Fei F, Firestone B, Fodor M, Fridrich C, Gao H, Grunenfelder D, Hao HX, Jacob J, Ho S, Hsiao K, Kang ZB, Karki R, Kato M, Larrow J, La Bonte LR, Lenoir F, Liu G, Liu S, Majumdar D, Meyer MJ, Palermo M, Perez L, Pu M, Price E, Quinn C, Shakya S, Shultz MD, Slisz J, Venkatesan K, Wang P, Warmuth M, Williams S, Yang G, Yuan J, Zhang JH, Zhu P, Ramsey T, Keen NJ, Sellers WR, Stams T, Fortin PD. Nature. 2016 Jul 7;535(7610):148-52. 10.1038/nature18621 PubMed 27362227