Skip to main content

bPAC-mycHis_pGEM
(Plasmid #85468)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 85468 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pGEM
  • Backbone size w/o insert (bp) 3152
  • Total vector size (bp) 4202

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Bacterial Photoactivated Adenylyl Cyclase
  • Alt name
    bPAC
  • Species
    Synthetic; Beggiatoa sp.
  • Insert Size (bp)
    1050
  • GenBank ID
    GU461307.1
  • Promoter T7 promoter
  • Tags / Fusion Proteins
    • Myc (C terminal on insert)
    • His (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (unknown if destroyed)
  • 3′ cloning site BsiWI (unknown if destroyed)
  • 5′ sequencing primer T7 forward
  • 3′ sequencing primer Seq12rv: GTGTAAGTTGGTATTATGTAG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    bPAC-mycHis_pGEM was a gift from Peter Hegemann (Addgene plasmid # 85468 ; http://n2t.net/addgene:85468 ; RRID:Addgene_85468)
  • For your References section:

    Light modulation of cellular cAMP by a small bacterial photoactivated adenylyl cyclase, bPAC, of the soil bacterium Beggiatoa. Stierl M, Stumpf P, Udwari D, Gueta R, Hagedorn R, Losi A, Gartner W, Petereit L, Efetova M, Schwarzel M, Oertner TG, Nagel G, Hegemann P. J Biol Chem. 2011 Jan 14. 286(2):1181-8. 10.1074/jbc.M110.185496 PubMed 21030594