pTC-CMV-Tet-YAP
(Plasmid
#85579)
-
PurposeSleeping beauty transposon for hydrodynamic tail vein injection for CreER expression and tetracyclin-dependent YAP expression (CMV promoter ) in mouse liver
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 85579 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepT3
- Backbone size w/o insert (bp) 3392
- Total vector size (bp) 11031
-
Vector typeMammalian Expression, Cre/Lox
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameCreER
-
Insert Size (bp)1985
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site BsiWI (unknown if destroyed)
- 3′ cloning site MluI (unknown if destroyed)
- 5′ sequencing primer seq intron fwd (TCTCCACAGGTGTCCACTCC) (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameYAP
-
Alt nameYes-assiciated protein
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1697
-
GenBank IDNC_000011.10
- Promoter TRE
-
Tag
/ Fusion Protein
- Flag (2x) (N terminal on insert)
Cloning Information for Gene/Insert 2
- Cloning method Gateway Cloning
- 5′ sequencing primer pCEP fwd (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byCreER sequence originally from addgene plasmid #12168 YAP sequence originally from addgene plasmid #19045
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTC-CMV-Tet-YAP was a gift from Ursula Ehmer (Addgene plasmid # 85579 ; http://n2t.net/addgene:85579 ; RRID:Addgene_85579) -
For your References section:
An in vivo transfection system for inducible gene expression and gene silencing in murine hepatocytes. Hubner EK, Lechler C, Kohnke-Ertel B, Zmoos AF, Sage J, Schmid RM, Ehmer U. J Gene Med. 2016 Dec 23. doi: 10.1002/jgm.2940. 10.1002/jgm.2940 PubMed 28009940