Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.
We will increase some of our prices at 12:00 AM ET on April 1, 2023. Be sure to complete your order before this time to take advantage of current prices. See the new prices and get more information or speak with our friendly support team.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pTC-ApoE-Tet
(Plasmid #85578)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 85578 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pT3
  • Backbone size w/o insert (bp) 3392
  • Total vector size (bp) 11193
  • Vector type
    Mammalian Expression, Cre/Lox

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol and Ampicillin, 25 & 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    ccdB Survival
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    CreER
  • Insert Size (bp)
    1985
  • Promoter ApoE.HCR.hAAT

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsiWI (unknown if destroyed)
  • 3′ cloning site MluI (unknown if destroyed)
  • 5′ sequencing primer seq intron fwd (TCTCCACAGGTGTCCACTCC)
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    CreER sequence originally from addgene plasmid #12168
  • Article Citing this Plasmid

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pTC-ApoE-Tet was a gift from Ursula Ehmer (Addgene plasmid # 85578 ; http://n2t.net/addgene:85578 ; RRID:Addgene_85578)