Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #85579)


Item Catalog # Description Quantity Price (USD)
Plasmid 85579 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone size w/o insert (bp) 3392
  • Total vector size (bp) 11031
  • Vector type
    Mammalian Expression, Cre/Lox

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
  • Insert Size (bp)

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsiWI (unknown if destroyed)
  • 3′ cloning site MluI (unknown if destroyed)
  • 5′ sequencing primer seq intron fwd (TCTCCACAGGTGTCCACTCC)
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
  • Alt name
    Yes-assiciated protein
  • Species
    H. sapiens (human)
  • Insert Size (bp)
  • GenBank ID
  • Promoter TRE
  • Tag / Fusion Protein
    • Flag (2x) (N terminal on insert)

Cloning Information for Gene/Insert 2

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    CreER sequence originally from addgene plasmid #12168 YAP sequence originally from addgene plasmid #19045

Terms and Licenses

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pTC-CMV-Tet-YAP was a gift from Ursula Ehmer (Addgene plasmid # 85579 ; ; RRID:Addgene_85579)