pSH-Csy4-T2A-SpRFN
(Plasmid #85754)

• Purpose: Expresses S. pyogenes FokI-dCas9-NLS with a 25 amino acid linker (GGGGS)5 fusion. Also expresses Csy4 for cleavage of multiplexed gRNA transcripts. Derived from pSQT1601 (Addgene #53369).
• Depositing Lab: Lawrence Stanton
• Publication: Havlicek et al Mol Ther. 2017 Feb 1;25(2):342-355. doi: 10.1016/j.ymthe.2016.11.007.

Backbone

• Vector backbone: pSQT-1601
• Backbone manufacturer: Keith Joung lab
• Backbone size w/o insert (bp): 4833
• Total vector size (bp): 10347
• Vector type: Mammalian Expression, CRISPR

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Csy4-T2A-FokI-dCas9
• Alt name: FokI-dCas9
• Alt name: SpRFN
• Alt name: RNA-guided FokI-nuclease
• Species: Streptococcus pyogenes
• Insert Size (bp): 4896
• Mutation: D10A, H840A
• Promoter: CAG
• Tags / Fusion Proteins:
  • FokI fusion via 25 amino acid (GGGGS)5 linker (N terminal on insert)
  • Csy4 (N terminal on backbone)

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: AGAGCCTCTGCTAACCATGTTC

Resource Information

• Supplemental Documents:
  • pSH-Csy4-T2A-SpRFN.ape
• A portion of this plasmid was derived from a plasmid made by: Plasmid cloned by Shengdar Q Tsai from Keith Joung lab. Plasmid received from Addgene (#53369).

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

We changed the FokI-dCas9 fusion linker in the pSQT-1601 plasmid to create plasmid pSH-Csy4-T2A-SpRFN.