pSH-Csy4-T2A-SpRFN
(Plasmid
#85754)
-
PurposeExpresses S. pyogenes FokI-dCas9-NLS with a 25 amino acid linker (GGGGS)5 fusion. Also expresses Csy4 for cleavage of multiplexed gRNA transcripts. Derived from pSQT1601 (Addgene #53369).
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 85754 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepSQT-1601
-
Backbone manufacturerKeith Joung lab
- Backbone size w/o insert (bp) 4833
- Total vector size (bp) 10347
-
Vector typeMammalian Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCsy4-T2A-FokI-dCas9
-
Alt nameFokI-dCas9
-
Alt nameSpRFN
-
Alt nameRNA-guided FokI-nuclease
-
SpeciesStreptococcus pyogenes
-
Insert Size (bp)4896
-
MutationD10A, H840A
- Promoter CAG
-
Tags
/ Fusion Proteins
- FokI fusion via 25 amino acid (GGGGS)5 linker (N terminal on insert)
- Csy4 (N terminal on backbone)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer AGAGCCTCTGCTAACCATGTTC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byPlasmid cloned by Shengdar Q Tsai from Keith Joung lab. Plasmid received from Addgene (#53369).
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
We changed the FokI-dCas9 fusion linker in the pSQT-1601 plasmid to create plasmid pSH-Csy4-T2A-SpRFN.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSH-Csy4-T2A-SpRFN was a gift from Lawrence Stanton (Addgene plasmid # 85754 ; http://n2t.net/addgene:85754 ; RRID:Addgene_85754) -
For your References section:
Re-engineered RNA-Guided FokI-Nucleases for Improved Genome Editing in Human Cells. Havlicek S, Shen Y, Alpagu Y, Bruntraeger MB, Zufir NB, Phuah ZY, Fu Z, Dunn NR, Stanton LW. Mol Ther. 2017 Feb 1;25(2):342-355. doi: 10.1016/j.ymthe.2016.11.007. 10.1016/j.ymthe.2016.11.007 PubMed 28153087