Skip to main content

pDONOR-SNCAe2-WT
(Plasmid #85845)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 85845 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pUC-AMPr based
  • Backbone size w/o insert (bp) 5888
  • Total vector size (bp) 12252
  • Vector type
    Mammalian Expression, Bacterial Expression
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    SNCA exon 2 homology arms
  • Alt name
    SNCA
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    6370
  • Mutation
    -
  • GenBank ID
    NG_011851.1
  • Entrez Gene
    SNCA (a.k.a. NACP, PARK1, PARK4, PD1)
  • Tag / Fusion Protein
    • -

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer AGATGTCCTAAATGCACAGCG
  • 3′ sequencing primer cgtcaattttacgcatgattatctttaac
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pDONOR-SNCAe2-WT was a gift from Jens Schwamborn (Addgene plasmid # 85845 ; http://n2t.net/addgene:85845 ; RRID:Addgene_85845)
  • For your References section:

    FACS-Assisted CRISPR-Cas9 Genome Editing Facilitates Parkinson's Disease Modeling. Arias-Fuenzalida J, Jarazo J, Qing X, Walter J, Gomez-Giro G, Nickels SL, Zaehres H, Scholer HR, Schwamborn JC. Stem Cell Reports. 2017 Nov 14;9(5):1423-1431. doi: 10.1016/j.stemcr.2017.08.026. Epub 2017 Oct 5. 10.1016/j.stemcr.2017.08.026 PubMed 28988985