pDONOR-SNCAe3-A53T
(Plasmid
#85848)
-
PurposeDonor plasmid for SNCA exon3 A53T sequence. Also contains EGFP and tagBFP
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 85848 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepUC-AMPr based
- Backbone size w/o insert (bp) 5888
- Total vector size (bp) 12082
-
Vector typeMammalian Expression, Bacterial Expression
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSNCA exon 3 homology arms
-
Alt nameSNCA
-
SpeciesH. sapiens (human)
-
Insert Size (bp)6184
-
GenBank IDNG_011851.1
-
Entrez GeneSNCA (a.k.a. NACP, PARK1, PARK4, PD1)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer AGATGTCCTAAATGCACAGCG
- 3′ sequencing primer cgtcaattttacgcatgattatctttaac (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pDONOR-SNCAe3-A53T was a gift from Jens Schwamborn (Addgene plasmid # 85848 ; http://n2t.net/addgene:85848 ; RRID:Addgene_85848) -
For your References section:
FACS-Assisted CRISPR-Cas9 Genome Editing Facilitates Parkinson's Disease Modeling. Arias-Fuenzalida J, Jarazo J, Qing X, Walter J, Gomez-Giro G, Nickels SL, Zaehres H, Scholer HR, Schwamborn JC. Stem Cell Reports. 2017 Nov 14;9(5):1423-1431. doi: 10.1016/j.stemcr.2017.08.026. Epub 2017 Oct 5. 10.1016/j.stemcr.2017.08.026 PubMed 28988985