-
PurposeOne-guide Perturb-seq vector backbone; modified mouse U6 promoter; constant region 2
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 85996 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepSICO derivative
-
Backbone manufacturerAddgene
- Backbone size w/o insert (bp) 8200
- Total vector size (bp) 9203
-
Vector typeMammalian Expression, Lentiviral, CRISPR
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameEGFP-NT2_cr2
-
gRNA/shRNA sequenceGFP
-
Insert Size (bp)113
- Promoter modified mouse U6
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer ACGGCGACTACTGCACTTAT
- 3′ sequencing primer gtacctagtggaaccggaac (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namepuro-T2A-BFP
-
gRNA/shRNA sequenceNA
-
Insert Size (bp)1371
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMJ179 was a gift from Jonathan Weissman (Addgene plasmid # 85996 ; http://n2t.net/addgene:85996 ; RRID:Addgene_85996) -
For your References section:
A Multiplexed Single-Cell CRISPR Screening Platform Enables Systematic Dissection of the Unfolded Protein Response. Adamson B, Norman TM, Jost M, Cho MY, Nunez JK, Chen Y, Villalta JE, Gilbert LA, Horlbeck MA, Hein MY, Pak RA, Gray AN, Gross CA, Dixit A, Parnas O, Regev A, Weissman JS. Cell. 2016 Dec 15;167(7):1867-1882.e21. doi: 10.1016/j.cell.2016.11.048. 10.1016/j.cell.2016.11.048 PubMed 27984733