Lenti CGIP + Z-AAT target
(Plasmid
#86007)
-
Purposelenti reporter plasmid with Z-AAT-specific gRNA target-sequence, to be used with tGFP #26864
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 86007 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backboneunknown
-
Vector typeLentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameCAG promoter
-
Alt nameCMV i/e enhancer + chicken beta-actin promoter
-
Insert Size (bp)1651
Cloning Information for Gene/Insert 1
- Cloning method Unknown
- 5′ sequencing primer TTACAAAAATTCAAAATTTTATC (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameZ-AAT target
-
SpeciesH. sapiens (human)
-
Insert Size (bp)59
-
MutationV30M
Cloning Information for Gene/Insert 2
- Cloning method Unknown
- 5′ sequencing primer TCCTGGGCAACGTGCTGGTTATTG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Lenti CGIP + Z-AAT target was a gift from Tobias Cantz (Addgene plasmid # 86007 ; http://n2t.net/addgene:86007 ; RRID:Addgene_86007) -
For your References section:
Improved bi-allelic modification of a transcriptionally silent locus in patient-derived iPSC by Cas9 nickase. Eggenschwiler R, Moslem M, Fraguas MS, Galla M, Papp O, Naujock M, Fonfara I, Gensch I, Wahner A, Beh-Pajooh A, Mussolino C, Tauscher M, Steinemann D, Wegner F, Petri S, Schambach A, Charpentier E, Cathomen T, Cantz T. Sci Rep. 2016 Dec 2;6:38198. doi: 10.1038/srep38198. 10.1038/srep38198 PubMed 27910942