Skip to main content

Lenti CGIP + TTR target
(Plasmid #86009)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 86009 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    unknown
  • Vector type
    Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    CAG promoter
  • Alt name
    CMV i/e enhancer + chicken beta-actin promoter
  • Insert Size (bp)
    1651

Cloning Information for Gene/Insert 1

Gene/Insert 2

  • Gene/Insert name
    TTR target
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    136
  • Mutation
    V30M

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (not destroyed)
  • 3′ cloning site AscI (not destroyed)
  • 5′ sequencing primer TCCTGGGCAACGTGCTGGTTATTG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Lenti CGIP + TTR target was a gift from Tobias Cantz (Addgene plasmid # 86009 ; http://n2t.net/addgene:86009 ; RRID:Addgene_86009)
  • For your References section:

    Improved bi-allelic modification of a transcriptionally silent locus in patient-derived iPSC by Cas9 nickase. Eggenschwiler R, Moslem M, Fraguas MS, Galla M, Papp O, Naujock M, Fonfara I, Gensch I, Wahner A, Beh-Pajooh A, Mussolino C, Tauscher M, Steinemann D, Wegner F, Petri S, Schambach A, Charpentier E, Cathomen T, Cantz T. Sci Rep. 2016 Dec 2;6:38198. doi: 10.1038/srep38198. 10.1038/srep38198 PubMed 27910942