Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.
We have implemented updates to our Transparency and Privacy Policy.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pQhsCDtRNA+
(Plasmid #86014)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 86014 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pQLinkN (Addgene #13670)
  • Backbone manufacturer
    Konrad Buessow lab
  • Vector type
    Bacterial Expression ; Co-Expression; Purification

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert 1

  • Gene/Insert name
    U14-tRNA chimera
  • Species
    H. sapiens (human)
  • Entrez Gene
    SNORD14A (a.k.a. RNU14, RNU14A, U14, U14-S13-5)
  • Promoter LPP

Cloning Information for Gene/Insert 1

Gene/Insert 2

  • Gene/Insert name
    15.5K
  • Species
    H. sapiens (human)
  • Entrez Gene
    SNU13 (a.k.a. 15.5K, FA-1, FA1, NHP2L1, NHPX, OTK27, SNRNP15-5, SPAG12, SSFA1)
  • Promoter Ptac

Cloning Information for Gene/Insert 2

Gene/Insert 3

  • Gene/Insert name
    fibrillarin
  • Species
    H. sapiens (human)
  • Mutation
    amino acids 83-316
  • Entrez Gene
    FBL (a.k.a. FIB, FLRN, Nop1, RNU3IP1)
  • Promoter Ptac

Cloning Information for Gene/Insert 3

Gene/Insert 4

  • Gene/Insert name
    NOP56
  • Species
    H. sapiens (human)
  • Mutation
    amino acids 1-411
  • Entrez Gene
    NOP56 (a.k.a. NOL5A, SCA36)
  • Promoter Ptac
  • Tag / Fusion Protein
    • 6x-His (C terminal on insert)

Cloning Information for Gene/Insert 4

Gene/Insert 5

  • Gene/Insert name
    NOP58
  • Species
    H. sapiens (human)
  • Mutation
    amino acids 1-401
  • Entrez Gene
    NOP58 (a.k.a. HSPC120, NOP5, NOP5/NOP58)
  • Promoter Ptac

Cloning Information for Gene/Insert 5

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer Unknown
  • 3′ sequencing primer pQE276, GGCAACCGAGCGTTCTGAAC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please see associated publication for additional graphics describing this plasmid.

Plasmid construction: To construct the human box C/D RNP plasmid, pQhsCDtRNA+, pQLinkN (Addgene #13670) was inserted with the coding sequences of Homo sapiens (Hs) NOP56 (amino acids 1 to 411), NOP58 (amino acids 1 to 401) and fibrillarin (amino acids 83 to 316), 15.5 K, and U14 snoRNA. Each protein-encoding gene was first cloned into pQLink-N plasmid using BamHI and NotI sites. The plasmids containing two different protein-encoding genes were then digested by SwaI and PacI, respectively, treated with LIC qualified T4 polymerase (dCTP for Pac I digest and dGTP for Swa I digest) and then annealed at 70°C. Each clone was identified by digestion of the recombined plasmid with Pac I. This process was repeated for additional coding sequence until all were inserted.
To construct the tRNA-RNA chimera, the DNA sequence of human U14 snoRNA was fused with that of E. coli initiator tRNAMet scaffold under the control of lpp promoter. The fused mini gene sequences contain the Xho I site, the LINK1 sequence (required for pQLink-N fusion), the lpp promoter, tRNA scaffold part I, sR3 sRNA/U14 snoRNA, tRNA scaffold part II, the rrnC terminator and the Hind III site. The Xho I and Hind III sites were used to clone the mini gene into the pQLink-N vector. Finally, the tRNA-sRNA/snoRNA segment was recombined with box C/D protein coding sequences via the LINK reaction of the pQLink system resulting in pQhsCDtRNA+. In addition, a plasmid containing all protein-encoding sequences without an inserted RNA mini gene, pQhsCD, were also constructed.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pQhsCDtRNA+ was a gift from Hong Li (Addgene plasmid # 86014 ; http://n2t.net/addgene:86014 ; RRID:Addgene_86014)
  • For your References section:

    Co-expression and co-purification of archaeal and eukaryal box C/D RNPs. Peng Y, Yu G, Tian S, Li H. PLoS One. 2014 Jul 31;9(7):e103096. doi: 10.1371/journal.pone.0103096. eCollection 2014. PONE-D-14-15013 [pii] PubMed 25078083