-
PurposeExpresses the RAS-binding domain of RAF1 for in vitro analysis of RAS activation
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 86033 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepDest-521
-
Backbone manufacturerin-house
- Backbone size w/o insert (bp) 5516
- Total vector size (bp) 6770
-
Modifications to backboneDerivative of pET43 modified for Gateway recombinational cloning
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameRAF1 RBD (Ras-binding domain)
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1154
-
MutationContains residues 1-149
-
Entrez GeneRAF1 (a.k.a. CMD1NN, CRAF, NS5, Raf-1, c-Raf)
- Promoter T7
-
Tag
/ Fusion Protein
- GST (N terminal on insert)
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer TTAATACGACTCACTATAGGGG
- 3′ sequencing primer ggtggtgctcgagatcctctggg
- (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
modified from a plasmid described originally in Taylor and Shalloway (1996), Current Biology 6(12): 1621-27. This construct contains an E. coli optimized DNA sequence to improve expression and Gateway elements for recombinational cloning.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
GST-thr-RAF1-RBD was a gift from Dominic Esposito (Addgene plasmid # 86033 ; http://n2t.net/addgene:86033 ; RRID:Addgene_86033)