GST-RP2-C86Y,P95L
(Plasmid
#86074)
-
PurposeA bacterial expression plasmid encoding ciliary localization effected RP2 (RP2-C86Y,P95L) with N-terminus GST-tag.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 86074 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepGEX-4T1
-
Backbone manufacturerGE Healthcare
- Backbone size w/o insert (bp) 4969
- Total vector size (bp) 6018
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameRP2
-
Alt nameretinitis pigmentosa 2
-
SpeciesH. sapiens (human)
-
MutationChanged cysteine-86 and proline-95 to tyrosine and leucine respectively
-
Entrez GeneRP2 (a.k.a. DELXp11.3, NM23-H10, NME10, TBCCD2, XRP2)
- Promoter tac
-
Tag
/ Fusion Protein
- GST (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site SalI (not destroyed)
- 5′ sequencing primer 5' GGCAAGCCACGTTTGGTG 3'
- 3′ sequencing primer 5' GGAGCTGCATGTGTCAGAGG 3' (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
GST-RP2-C86Y,P95L was a gift from Lei Lu (Addgene plasmid # 86074 ; http://n2t.net/addgene:86074 ; RRID:Addgene_86074) -
For your References section:
A ternary complex comprising transportin1, Rab8 and the ciliary targeting signal directs proteins to ciliary membranes. Madugula V, Lu L. J Cell Sci. 2016 Oct 15;129(20):3922-3934. Epub 2016 Sep 15. 10.1242/jcs.194019 PubMed 27633000