-
Purposeexpresses the human HMG-CoA reductase isoform 1
-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 86085 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCMV-SPORT6-hHMGCR2
-
Backbone manufacturerI.M.A.G.E consortium (Library NIH_MGC_118, Image Id 5212903)
- Backbone size w/o insert (bp) 5639
- Total vector size (bp) 8305
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namehuman HMG-CoA Reductase isoform 1
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2666
-
GenBank IDNM_000859.2
-
Entrez GeneHMGCR (a.k.a. LDLCQ3, LGMDR28, MYPLG)
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BstBI (not destroyed)
- 3′ cloning site PvuII (not destroyed)
- 5′ sequencing primer ccggactctagcctaggccg
- 3′ sequencing primer tcctttagaacccaatgccc (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made bythe I.M.A.G.E consortium (pCMV-SPORT6-hHMGCR2, Library NIH_MGC_118, Image Id 5212903),
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The pCMV-SPORT6-hHMGCR1 plasmid was obtained by inserting a fragment of human HMGCR1 in the pCMV-SPORT6-hHMGCR2 plasmid (Library NIH_MGC_118, Image Id 5212903) using BstBI and PvuII unique restriction sites.
Addgene note: This plasmid also contains a portion of the 3' UTR of HMCGR1.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCMV-SPORT6-hHMGCR1 was a gift from Anne Galy (Addgene plasmid # 86085 ; http://n2t.net/addgene:86085 ; RRID:Addgene_86085)
Map uploaded by the depositor.