Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pCMV-SPORT6-hHMGCR1
(Plasmid #86085)

Full plasmid sequence is not available for this item.

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 86085 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pCMV-SPORT6-hHMGCR2
  • Backbone manufacturer
    I.M.A.G.E consortium (Library NIH_MGC_118, Image Id 5212903)
  • Backbone size w/o insert (bp) 5639
  • Total vector size (bp) 8305
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    human HMG-CoA Reductase isoform 1
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    2666
  • GenBank ID
    NM_000859.2
  • Entrez Gene
    HMGCR (a.k.a. LDLCQ3, LGMDR28, MYPLG)
  • Promoter CMV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BstBI (not destroyed)
  • 3′ cloning site PvuII (not destroyed)
  • 5′ sequencing primer ccggactctagcctaggccg
  • 3′ sequencing primer tcctttagaacccaatgccc
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    the I.M.A.G.E consortium (pCMV-SPORT6-hHMGCR2, Library NIH_MGC_118, Image Id 5212903),
  • Articles Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The pCMV-SPORT6-hHMGCR1 plasmid was obtained by inserting a fragment of human HMGCR1 in the pCMV-SPORT6-hHMGCR2 plasmid (Library NIH_MGC_118, Image Id 5212903) using BstBI and PvuII unique restriction sites.

Addgene note: This plasmid also contains a portion of the 3' UTR of HMCGR1.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCMV-SPORT6-hHMGCR1 was a gift from Anne Galy (Addgene plasmid # 86085 ; http://n2t.net/addgene:86085 ; RRID:Addgene_86085)