pLacI265-Wasabi
(Plasmid
#86103)
-
PurposemWasabi reporter gene gated by temperature-sensitive LacI G265D
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 86103 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepETDuet-1
-
Backbone manufacturerNovagen
-
Modifications to backboneT7 Promoter #1 replaced with T7A1O4/O3 T7 Promoter #2 deleted
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameLacIts
-
Alt nameLac Repressor (Temperature Sensitive)
-
Insert Size (bp)1083
-
MutationG265D
- Promoter pLacI
Cloning Information for Gene/Insert 1
- Cloning method Unknown
- 5′ sequencing primer ACTACTGGGCTGCTTCC
- 3′ sequencing primer gttaagggcggttttttcc
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namemWasabi
-
Insert Size (bp)756
-
GenBank IDEU024648.1
- Promoter T7A1O4/O3
-
Tag
/ Fusion Protein
- 6xHis (N terminal on insert)
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site HindIII (destroyed during cloning)
- 5′ sequencing primer ATGCGTCCGGCGTAGA
- 3′ sequencing primer CTAGTTATTGCTCAGCGGTG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLacI265-Wasabi was a gift from Mikhail Shapiro (Addgene plasmid # 86103 ; http://n2t.net/addgene:86103 ; RRID:Addgene_86103) -
For your References section:
Tunable thermal bioswitches for in vivo control of microbial therapeutics. Piraner DI, Abedi MH, Moser BA, Lee-Gosselin A, Shapiro MG. Nat Chem Biol. 2017 Jan;13(1):75-80. doi: 10.1038/nchembio.2233. Epub 2016 Nov 14. 10.1038/nchembio.2233 PubMed 27842069