Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #86104)


Item Catalog # Description Quantity Price (USD)
Plasmid 86104 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
  • Modifications to backbone
    T7 Promoter #1 replaced with pTetR/TetA promoters T7 Promoter #2 deleted
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
  • Alt name
    Tet Repressor (temperature sensitive)
  • Insert Size (bp)
  • Mutation
  • Promoter ptetR

Cloning Information for Gene/Insert 1

  • Cloning method Gibson Cloning
  • 5′ sequencing primer ATCTTCATGTCGGGC
  • 3′ sequencing primer ctggttcaccacgcgg
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
  • Insert Size (bp)
  • GenBank ID
  • Promoter ptetA
  • Tag / Fusion Protein
    • 6xHis (N terminal on insert)

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site HindIII (destroyed during cloning)
  • 5′ sequencing primer ACATCTAAAACTTTTAGCGT
  • 3′ sequencing primer GCTAGTTATTGCTCAGCGG
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pTetR89-Wasabi was a gift from Mikhail Shapiro (Addgene plasmid # 86104 ; ; RRID:Addgene_86104)
  • For your References section:

    Tunable thermal bioswitches for in vivo control of microbial therapeutics. Piraner DI, Abedi MH, Moser BA, Lee-Gosselin A, Shapiro MG. Nat Chem Biol. 2017 Jan;13(1):75-80. doi: 10.1038/nchembio.2233. Epub 2016 Nov 14. 10.1038/nchembio.2233 PubMed 27842069