Skip to main content

plentiCRISPRv2-sgPLXNB2
(Plasmid #86152)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 86152 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    plentiCRISPRv2
  • Backbone manufacturer
    Feng Zhang laboratory, MIT
  • Backbone size w/o insert (bp) 12992
  • Total vector size (bp) 13012
  • Vector type
    Lentiviral, CRISPR
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Plexin-B2
  • Alt name
    PLXNB2
  • gRNA/shRNA sequence
    GTTCTCGGCGGCGACCGTCA
  • Species
    H. sapiens (human)
  • Entrez Gene
    PLXNB2 (a.k.a. MM1, Nbla00445, PLEXB2, dJ402G11.3)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsmBI (destroyed during cloning)
  • 3′ cloning site BsmBI (destroyed during cloning)
  • 5′ sequencing primer U6-fwd
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    plentiCRISPRv2-sgPLXNB2 was a gift from Roland Friedel (Addgene plasmid # 86152 ; http://n2t.net/addgene:86152 ; RRID:Addgene_86152)
  • For your References section:

    Plexin-B2 facilitates glioblastoma infiltration by modulating cell biomechanics. Huang Y, Tejero R, Lee VK, Brusco C, Hannah T, Bertucci TB, Junqueira Alves C, Katsyv I, Kluge M, Foty R, Zhang B, Friedel CC, Dai G, Zou H, Friedel RH. Commun Biol. 2021 Jan 29;4(1):145. doi: 10.1038/s42003-021-01667-4. 10.1038/s42003-021-01667-4 PubMed 33514835