plentiCRISPRv2-sgEGFP
(Plasmid
#86153)
-
PurposeLentivirus carrying Cas9/CRISPR for cut in GFP (used as control)
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 86153 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneplentiCRISPRv2
-
Backbone manufacturerFeng Zhang laboratory, MIT
- Backbone size w/o insert (bp) 12992
- Total vector size (bp) 13012
-
Vector typeLentiviral, CRISPR
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameEGFP
-
gRNA/shRNA sequenceGGGCGAGGAGCTGTTCACCG
-
SpeciesSynthetic
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsmBI (destroyed during cloning)
- 3′ cloning site BsmBI (destroyed during cloning)
- 5′ sequencing primer U6-fwd
- (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
This lenti-CRISPRv2 vector was used as control for studies with gene specific lenti-CRISPRv2 gene deletion of Plexin-B2 in human cells (plentiCRISPRv2-sgPLXNB2).
Plasmid received from Jialiang Liang, Laboratory of Patrizia Casaccia, Icahn School of Medicine at Mount Sinai
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
plentiCRISPRv2-sgEGFP was a gift from Roland Friedel (Addgene plasmid # 86153 ; http://n2t.net/addgene:86153 ; RRID:Addgene_86153) -
For your References section:
Plexin-B2 facilitates glioblastoma infiltration by modulating cell biomechanics. Huang Y, Tejero R, Lee VK, Brusco C, Hannah T, Bertucci TB, Junqueira Alves C, Katsyv I, Kluge M, Foty R, Zhang B, Friedel CC, Dai G, Zou H, Friedel RH. Commun Biol. 2021 Jan 29;4(1):145. doi: 10.1038/s42003-021-01667-4. 10.1038/s42003-021-01667-4 PubMed 33514835