pDONOR-PARK6e5-I368N
              
              
                (Plasmid
                
                #86154)
              
            
            
            
          - 
            PurposeDonor plasmid for PARK6 exon5 I368N sequence. Also contains TagBFP and dTomato
- 
              Depositing Lab
- 
          Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 86154 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
- 
            Vector backbonepUC-AMPr based
- Backbone size w/o insert (bp) 5888
- Total vector size (bp) 11821
- 
              Vector typeMammalian Expression, Bacterial Expression
- 
                Selectable markersPuromycin
Growth in Bacteria
- 
            Bacterial Resistance(s)Ampicillin, 100 μg/mL
- 
            Growth Temperature37°C
- 
            Growth Strain(s)NEB Stable
- 
            Copy numberHigh Copy
Gene/Insert
- 
                Gene/Insert namePINK1 exon 5 homology arms
- 
                  Alt namePINK1
- 
                  Alt namePARK6
- 
                  Alt nameBPRK
- 
                    SpeciesH. sapiens (human)
- 
                  Insert Size (bp)5939
- 
                    GenBank IDNC_000001.11 NP_115785.1
- 
                        Entrez GenePINK1 (a.k.a. BRPK, PARK6)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer AGATGTCCTAAATGCACAGCG
- 3′ sequencing primer cgtcaattttacgcatgattatctttaac (Common Sequencing Primers)
Resource Information
- 
            
            
            Supplemental Documents
- 
            
            
            Addgene Notes
Terms and Licenses
- 
        Academic/Nonprofit Terms
- 
      Industry Terms- Not Available to Industry
 
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
- 
              For your Materials & Methods section: pDONOR-PARK6e5-I368N was a gift from Jens Schwamborn (Addgene plasmid # 86154 ; http://n2t.net/addgene:86154 ; RRID:Addgene_86154)
- 
                For your References section: FACS-Assisted CRISPR-Cas9 Genome Editing Facilitates Parkinson's Disease Modeling. Arias-Fuenzalida J, Jarazo J, Qing X, Walter J, Gomez-Giro G, Nickels SL, Zaehres H, Scholer HR, Schwamborn JC. Stem Cell Reports. 2017 Nov 14;9(5):1423-1431. doi: 10.1016/j.stemcr.2017.08.026. Epub 2017 Oct 5. 10.1016/j.stemcr.2017.08.026 PubMed 28988985
