Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Addgene is operating at a reduced capacity.

  • Pending order? We will email to confirm that your organization can accept shipments.
  • Conducting coronavirus or COVID-19 research? Email us at [email protected] with your order or deposit number so we can prioritize it.

Learn more about our current shipping status and COVID-19 resources.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #86194)


Item Catalog # Description Quantity Price (USD)
Plasmid 86194 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
    pTRE-Tight BI
  • Backbone manufacturer
  • Backbone size w/o insert (bp) 2800
  • Total vector size (bp) 6048
  • Vector type
    Mammalian Expression ; Tet on

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy


  • Gene/Insert name
    beta Globin
  • Species
    H. sapiens (human), M. musculus (mouse)
  • Mutation
    39TER in beta Globin in MCS II
  • Entrez Gene
    HBB (a.k.a. CD113t-C, ECYT6, beta-globin)
  • Entrez Gene
  • Promoter Tet on

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SmaI (unknown if destroyed)
  • 3′ cloning site NheI (unknown if destroyed)
  • 5′ sequencing primer CCTGGAGATTTCGAGCTCGG
  • 3′ sequencing primer TAT TAC CGC CTT TGA GTG AGC TGA
  • (Common Sequencing Primers)

Resource Information

  • Terms and Licenses
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pTRE-Tight-BI-Gl NORM-LacZA-TER-LacZB was a gift from Robert Singer (Addgene plasmid # 86194 ; ; RRID:Addgene_86194)
  • For your References section:

    Temporal and spatial characterization of nonsense-mediated mRNA decay. Trcek T, Sato H, Singer RH, Maquat LE. Genes Dev. 2013 Mar 1;27(5):541-51. doi: 10.1101/gad.209635.112. Epub 2013 Feb 21. 10.1101/gad.209635.112 PubMed 23431032