Hbb
Addgene Alerts
You can receive an email alert when new materials related to this gene are available at Addgene.
Log in to manage alertsPlasmids containing this gene
| ID | Plasmid | Gene/Insert | PI |
|---|---|---|---|
| 86194 | pTRE-Tight-BI-Gl NORM-LacZA-TER-LacZB | beta Globin (Homo sapiens) | Singer |
| 86212 | pPonA-BI-Gl NORM-LacZA TER- LacZB | beta-Globin (Homo sapiens) | Singer |
| 99692 | pAAV-SCP1-dSa VPR mini.-2X snRP-1 Hbb | dCas9 and gRNA targeting Hbb (Synthetic) | Church |
| 99693 | pAAV-CMV-dSa VP64 Hbb | dCas9 and gRNA targeting Hbb (gRNA: GGGGTAAGGGGAGCAAGGTC) (Mus musculus) | Church |
| 189793 | PonA-BI-Gl-WT-18xPP7-WT-24xMS2 (Switch) | beta-globin (Homo sapiens) | Singer |