Skip to main content

pFETCh_ZNF644
(Plasmid #86264)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 86264 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pFETCh_Donor
  • Vector type
    CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    ZNF644 homology arms
  • Species
    H. sapiens (human)
  • Entrez Gene
    ZNF644 (a.k.a. BM-005, MYP21, NatF, ZEP-2)
  • Tag / Fusion Protein
    • 3XFLAG-P2A-NeoR (C terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer acgcctgtgaaaccgtacta
  • 3′ sequencing primer aactgttgggaagggcgatc
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

This plasmid was co-transfected along with PX458_ZNF644_1 and PX458_ZNF644_2 into HepG2 cells, and genomic editing was verified by PCR. We performed ChIP-seq on this cell line using anti-FLAG Sigma F1804 and obtained data that passed our quality tests. Immunoprecipitation with anti-FLAG Sigma F1804 followed by mass spectrometry identified ZNF644. All released data, including ChIP-seq files and validation data, are available at the ENCODE web portal: https://www.encodeproject.org/search/?searchTerm=flag&type=Experiment&lab.title=Richard+Myers%2C+HAIB . Note: This plasmid is part of the Mendenhall and Meyers CRISPR-based Tagging system to add a tag (currently using FLAG) to endogenous proteins. Please see https://www.addgene.org/crispr/tagging/ for more details.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pFETCh_ZNF644 was a gift from Eric Mendenhall & Richard M. Myers (Addgene plasmid # 86264 ; http://n2t.net/addgene:86264 ; RRID:Addgene_86264)
  • For your References section:

    CETCh-seq: CRISPR epitope tagging ChIP-seq of DNA-binding proteins. Savic D, Partridge EC, Newberry KM, Smith SB, Meadows SK, Roberts BS, Mackiewicz M, Mendenhall EM, Myers RM. Genome Res. 2015 Sep 9. 10.1101/gr.193540.115 PubMed 26355004