pFETCh_KAT7
(Plasmid #86266)

• Purpose: Donor vector for 3' FLAG tag of human KAT7
• Depositing Labs: Eric Mendenhall, Richard M. Myers
• Depositing Organization: University of Alabama in Huntsville
  Located in United States of America
• Publication: Savic et al Genome Res. 2015 Sep 9.
• Citations: 1 Article

Backbone

• Vector backbone: pFETCh_Donor
• Vector type: CRISPR

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: KAT7 homology arms
• Species: H. sapiens (human)
• Entrez Gene: KAT7 (a.k.a. HBO1, HBOA, MYST2, ZC2HC7)
• Tag / Fusion Protein:
  • 3XFLAG-P2A-NeoR (C terminal on insert)

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: acgcctgtgaaaccgtacta
• 3′ sequencing primer: aactgttgggaagggcgatc

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

This plasmid was co-transfected along with PX458_KAT7_1 into HepG2 cells, and genomic editing was verified by PCR. The donor nucleotide sequence in the final two codons of the KAT7 gene are modified to discourage sgRNA recognition, while retaining the native amino acid sequence. We performed ChIP-seq on this cell line using anti-FLAG Sigma F1804 and obtained data that passed our quality tests. Immunoprecipitation with anti-FLAG Sigma F1804 followed by mass spectrometry identified KAT7. All released data, including ChIP-seq files and validation data, are available at the ENCODE web portal: https://www.encodeproject.org/search/?searchTerm=flag&type=Experiment&lab.title=Richard+Myers%2C+HAIB . Note: This plasmid is part of the Mendenhall and Meyers CRISPR-based Tagging system to add a tag (currently using FLAG) to endogenous proteins. Please see https://www.addgene.org/crispr/tagging/ for more details.

DNA (Catalog # 86266-D50)

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

• Amount: 50 μg
• Concentration: 1 μg/μL
• Pricing: $495 USD
• Storage: 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

DNA (Catalog # 86266-D100)

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

• Amount: 100 μg
• Concentration: 1 μg/μL
• Pricing: $585 USD
• Storage: 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.