-
Purposefor C-terminal tagging with eDHFR trimethoprim regulated degron with puro selection
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 86395 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepAc5
-
Vector typeCRISPR
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameHA3 eDHFR T2A puro
-
SpeciesE coli
-
MutationR12Y, G67S and Y100I mutations in E coli DHFR
-
Tag
/ Fusion Protein
- HA3 eDHFR T2A puro
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (destroyed during cloning)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer ggaggcggttacccatac
- 3′ sequencing primer gtcgactgatcataatcagc (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byThe mutant E coli DHFR gene used in the two plasmids was derived from Cho et al PlosOne 8: e72393 Addgene plasmid 29325.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
pAc5 HA3-eDHFR-T2A-puro was derived from pAc5gRNA Cas9 (Bassett, A.R.,et al Biol Open 3:42, 2014) by replacing the EcoRI-Hind III fragment encoding Cas9 with a PCR fragment encoding HA3-eDHFR amplified from pBMN DHFR(DD)-YFP (Iwamoto eet al Chem Biol 17:981, 2010.) (Addgene plasmid #29325)
This degron has R12Y, G67S and Y100I mutations in eDHFR
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAc5 HA3-eDHFR-T2A-puro was a gift from David Bentley (Addgene plasmid # 86395 ; http://n2t.net/addgene:86395 ; RRID:Addgene_86395) -
For your References section:
Selectable one-step PCR-mediated integration of a degron for rapid depletion of endogenous human proteins. Sheridan RM, Bentley DL. Biotechniques. 2016 Feb 1;60(2):69-74. doi: 10.2144/000114378. eCollection 2016 Feb. 10.2144/000114378 PubMed 26842351