Skip to main content

pAc5 HA3-eDHFR-T2A-puro
(Plasmid #86395)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 86395 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 86395-D50 50 μg of DNA in Tris buffer $495
DNA 86395-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pAc5
  • Vector type
    CRISPR
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    HA3 eDHFR T2A puro
  • Species
    E coli
  • Mutation
    R12Y, G67S and Y100I mutations in E coli DHFR
  • Tag / Fusion Protein
    • HA3 eDHFR T2A puro

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (destroyed during cloning)
  • 3′ cloning site HindIII (not destroyed)
  • 5′ sequencing primer ggaggcggttacccatac
  • 3′ sequencing primer gtcgactgatcataatcagc
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    The mutant E coli DHFR gene used in the two plasmids was derived from Cho et al PlosOne 8: e72393 Addgene plasmid 29325.

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

pAc5 HA3-eDHFR-T2A-puro was derived from pAc5gRNA Cas9 (Bassett, A.R.,et al Biol Open 3:42, 2014) by replacing the EcoRI-Hind III fragment encoding Cas9 with a PCR fragment encoding HA3-eDHFR amplified from pBMN DHFR(DD)-YFP (Iwamoto eet al Chem Biol 17:981, 2010.) (Addgene plasmid #29325)
This degron has R12Y, G67S and Y100I mutations in eDHFR

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAc5 HA3-eDHFR-T2A-puro was a gift from David Bentley (Addgene plasmid # 86395 ; http://n2t.net/addgene:86395 ; RRID:Addgene_86395)
  • For your References section:

    Selectable one-step PCR-mediated integration of a degron for rapid depletion of endogenous human proteins. Sheridan RM, Bentley DL. Biotechniques. 2016 Feb 1;60(2):69-74. doi: 10.2144/000114378. eCollection 2016 Feb. 10.2144/000114378 PubMed 26842351