Skip to main content

pLVTHM-shRnd3
(Plasmid #86437)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 86437 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pLVTHM
  • Backbone manufacturer
    Didier Trono Lab (Addgene #12247)
  • Vector type
    Mammalian Expression, Lentiviral, RNAi

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    shRNA targeting RND3
  • gRNA/shRNA sequence
    TAGTAGAGCTCTCCAATCACA
  • Species
    H. sapiens (human)
  • Entrez Gene
    RND3 (a.k.a. ARHE, Rho8, RhoE, memB)
  • Promoter H1

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (unknown if destroyed)
  • 3′ cloning site MluI (unknown if destroyed)
  • 5′ sequencing primer H1 (5' tcgctatgtgttctgggaaa 3')
  • 3′ sequencing primer SP6
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLVTHM-shRnd3 was a gift from Violaine Moreau (Addgene plasmid # 86437 ; http://n2t.net/addgene:86437 ; RRID:Addgene_86437)
  • For your References section:

    Rnd3/RhoE Is down-regulated in hepatocellular carcinoma and controls cellular invasion. Grise F, Sena S, Bidaud-Meynard A, Baud J, Hiriart JB, Makki K, Dugot-Senant N, Staedel C, Bioulac-Sage P, Zucman-Rossi J, Rosenbaum J, Moreau V. Hepatology. 2012 Jun;55(6):1766-75. doi: 10.1002/hep.25568. 10.1002/hep.25568 PubMed 22234932