-
Purpose(Empty Backbone) A modified version of the Promega pGL4.23 vector. Contains the MYC promoter in place of the minimal promoter and polyadenylation signals flanking the enhancer cloning site.
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 86461 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepGL4.23
-
Backbone manufacturerPromega
- Backbone size (bp) 4500
-
Vector typeMammalian Expression, Luciferase
- Promoter MYC
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin and Kanamycin, 100 & 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer RVprimer3 CTAGCAAAATAGGCTGTCCC
- 3′ sequencing primer L4440 AGCGAGTCAGTGAGCGAG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Use FspI and AclI to remove the kanamycin resistance cassette and replace with putative regulatory elements by Gibson cloning.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGL4.23-MYC was a gift from Eric Lander (Addgene plasmid # 86461 ; http://n2t.net/addgene:86461 ; RRID:Addgene_86461) -
For your References section:
Systematic mapping of functional enhancer-promoter connections with CRISPR interference. Fulco CP, Munschauer M, Anyoha R, Munson G, Grossman SR, Perez EM, Kane M, Cleary B, Lander ES, Engreitz JM. Science. 2016 Sep 29. pii: aag2445. 10.1126/science.aag2445 PubMed 27708057