Skip to main content
Addgene

RSV-Flag-Brd3
(Plasmid #86615)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 86615 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pAdRSV-Sp-Flag
  • Backbone manufacturer
    PMID: 12490204
  • Backbone size w/o insert (bp) 4260
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Brd3
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    2204
  • Entrez Gene
    Brd3 (a.k.a. 2410084F24Rik, AW060456, Fsrg2, ORFX, RINGL3)
  • Promoter RSV
  • Tag / Fusion Protein
    • Flag (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI-klenow (destroyed during cloning)
  • 3′ cloning site EcoRI-klenow (destroyed during cloning)
  • 5′ sequencing primer CCTCAGTGGATGTTGCCTTTAC
  • 3′ sequencing primer GCATTCTAGTTGTGGTTTGTCC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    RSV-Flag-Brd3 was a gift from Mario García-Domínguez (Addgene plasmid # 86615 ; http://n2t.net/addgene:86615 ; RRID:Addgene_86615)
  • For your References section:

    Association of bromodomain BET proteins with chromatin requires dimerization through the conserved motif B. Garcia-Gutierrez P, Mundi M, Garcia-Dominguez M. J Cell Sci. 2012 Aug 1;125(Pt 15):3671-80. Epub 2012 May 17. 10.1242/jcs.105841 PubMed 22595521